circad | circRNAs associated with diseases

hsa_circRNA_101238/hsa_circ_0004372
Gene	PAN3	Organism	Human
Genome Locus	chr13:28748408-28752072:+	Build	hg19
Disease	Thoracic Aortic Dissection	ICD-10	Injury of thoracic aorta (S25.0)
DBLink	Link to database	PMID	29137225
Experimental Method
Sample Type	Tissues	Comparison	Aortic segments between human type A Thoracic Aortic Dissection (TAD) patients (n=3) and age-matched normal donors (NA; n=3)
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCAATAAAGCTGGTGCTAAAATAGGA Reverse CTTGTTTAATGACTTTGGTGCCCT	Statistics	Fold Change : Upregulated,1.694 pvalue : p=0.016
Citation
Zou, M, Huang, C, Li, X, He, X, Chen, Y, Liao, W, Liao, Y, Sun, J, Liu, Z, Zhong, L, Bin, J (2017). Circular RNA expression profile and potential function of hsa_circRNA_101238 in human thoracic aortic dissection. Oncotarget, 8, 47:81825-81837.